Fact-checked by Grok 2 weeks ago

Internal transcribed spacer

The internal transcribed spacer (ITS) is a region within the eukaryotic nuclear (rRNA) , situated between the encoding the small-subunit (18S) rRNA and large-subunit (28S) rRNA, and consisting of two spacers—ITS1 and ITS2—flanking the conserved 5.8S rRNA . This region is transcribed as part of the pre-rRNA precursor by but is subsequently cleaved and degraded during rRNA maturation, serving no direct functional role in protein synthesis while exhibiting high sequence variability that reflects divergence. In , the ITS is prized for its rapid and species-specific polymorphisms, enabling precise phylogenetic analyses and taxonomic across diverse eukaryotes, with particular prominence in fungi where it functions as the official universal DNA marker due to a clear "barcode gap" between intra- and interspecific variation. Applications extend to , protists, and , including cryptic species detection in parasites like digeneans and monogeneans, as well as barcoding in nematodes and mosquitoes, supported by extensive sequence databases such as and UNITE containing over 3.8 million fungal ITS sequences, representing approximately 751,000 hypotheses with at least two sequences, as of November 2025. Despite its utility, challenges arise from intragenomic heterogeneity in multicopy rDNA arrays, which can complicate interpretations in groups like basidiomycetes.

Occurrence Across Life Domains

In Eukaryotes

The internal transcribed spacer (ITS) consists of two sequences, ITS1 and ITS2, situated between the genes encoding the small subunit (18S or SSU) , the 5.8S , and the large subunit (28S or LSU) within the (rDNA) operons of eukaryotes. These spacers are transcribed as part of a single precursor rRNA molecule and subsequently removed during rRNA maturation. ITS regions occur universally in the nuclear rDNA of all major eukaryotic lineages, encompassing animals (Metazoa), (Viridiplantae), fungi, and protists. This conservation reflects the fundamental role of ribosomal genes across eukaryotic diversity, with over 985,000 ITS1 sequences documented as of 2018 spanning more than 130,000 species in these groups (e.g., as of November 2025, fungal ITS sequences alone exceed 3.8 million in the UNITE database). In terms of length, ITS1 typically spans 150–400 base pairs (bp) and ITS2 150–300 bp across eukaryotes, though 91.7% of ITS1 sequences fall within 100–300 bp. Variations are taxon-specific: in vertebrates and other animals, the spacers are generally shorter (ITS2 averaging ~306 bp) and exhibit lower sequence variability, making them more suitable for resolving higher taxonomic levels rather than species delineation. In contrast, fungal ITS regions often range 500–800 bp overall (including the intervening 5.8S gene) and display high interspecific variability, facilitating species-level identification with a success rate of up to 73%. Plant ITS sequences, averaging 221–260 bp for ITS2, show moderate variability that supports phylogenomic analyses and barcoding across dicotyledons, monocotyledons, gymnosperms, ferns, and mosses. Protist ITS lengths align with the broader eukaryotic range of 100–300 bp, contributing to diversity studies in these unicellular eukaryotes.

In Prokaryotes

In prokaryotes, the internal transcribed spacer (ITS) serves as the intergenic region between the 16S and (rRNA) genes in the ribosomal RNA operon, which typically also encompasses the 5S rRNA gene downstream of the 23S gene. This spacer is transcribed as part of the polycistronic pre-rRNA precursor and subsequently removed during rRNA maturation. Unlike the two ITS regions in eukaryotic nuclear rDNA, prokaryotes feature a single ITS between the 16S and 23S genes, reflecting a more streamlined structure evolved for efficient . In , ITS regions exhibit considerable length variability, often ranging from 200 to 1,500 base pairs (bp) depending on the inclusion of tRNA genes, and frequently incorporate one or more tRNA genes such as tRNAIle (isoleucine) and tRNAAla (alanine). These tRNA genes are interspersed within the spacer and processed separately from the rRNAs. Bacterial genomes often contain multiple rRNA operons—ranging from 1 to 15 copies per chromosome, with harboring seven—leading to potential intra-genomic sequence variability in the ITS due to or copy number effects. Although primarily non-coding in the mature , ITS sequences may harbor regulatory elements influencing operon transcription or processing efficiency. Archaea display a comparable ITS organization within their rRNA s, generally following the 16S-ITS-23S-5S arrangement, though with domain-specific sequence motifs that distinguish them from counterparts, such as unique promoter elements or processing signals in euryarchaeotes. Like , archaeal genomes typically possess 1 to 4 operon copies, contributing to similar intra-genomic heterogeneity. A representative bacterial example is found in , where type B operons (rrnA, rrnE, rrnH) feature an ITS containing both tRNAIle and tRNAAla genes, while type A operons (rrnB, rrnC, rrnD, rrnG) have a shorter spacer with only tRNAGlu (glutamate). In mycobacteria, the ITS region's sequence variability has been exploited for strain differentiation, as demonstrated by sequevar analysis in avium isolates, where distinct ITS types correlate with clinical and environmental groupings.

Structural Organization

Composition of ITS Regions

The internal transcribed spacer (ITS) regions consist of two non-coding sequences within the (rRNA) precursor transcript: ITS1 and ITS2. ITS1 is located between the small subunit ( gene—18S in eukaryotes and 16S in prokaryotes—and the 5.8S rRNA gene, while ITS2 lies between the 5.8S rRNA gene and the large subunit (LSU) rRNA gene—28S in eukaryotes and 23S in prokaryotes. In prokaryotes, the ITS often includes one or more tRNA genes, such as those encoding tRNAIle and tRNAAla. These spacers are flanked by highly conserved sequences from the adjacent rRNA genes, which define their precise boundaries: the 3' end of the marks the start of ITS1, and the 5' end of the 5.8S rRNA marks its end, whereas the 3' end of the 5.8S rRNA delineates the beginning of ITS2, and the 5' end of the LSU rRNA its conclusion. ITS1 is delimited by the 3' end of the gene and the 5' end of the 5.8S rRNA gene, with conserved sequences serving as recognition sites for endonucleolytic cleavage during rRNA processing. In contrast, ITS2 commonly exhibits a conserved secondary featuring multiple loops, which contribute to its stability and are preserved across eukaryotic lineages despite sequence divergence. These structural motifs, including four helices in eukaryotes, are integral to the spacer's architecture and are identifiable through comparative . The composition of ITS regions is generally AT-rich in many taxa, reflecting a bias toward and bases that facilitates rapid and processing. varies significantly by domain and group; for instance, in fungi, it typically ranges from 40% to 60%, with ITS2 often showing higher levels than ITS1 (e.g., means of approximately 54% and 59% in major fungal clades like ). Lengths of these regions also differ across life domains, with prokaryotic ITS regions exhibiting considerable length variation (typically 60–1,500 or more), generally shorter than many eukaryotic ones (which can exceed 1,000 ).

Sequence Variability and Conservation

The internal transcribed spacers (ITS1 and ITS2) exhibit high inter-specific variability, attributed to their rapid evolutionary rates, which makes them particularly suitable for resolving relationships at the species level across eukaryotes. This variability arises from minimal functional constraints on the non-coding spacers, allowing for accumulation of and indels that distinguish closely related taxa, with ITS1 often showing greater heterogeneity and divergence than ITS2 in many lineages such as fungi and . For instance, in fungal species, inter-specific differences in ITS can exceed 20-30% , enabling precise taxonomic discrimination where conserved rRNA genes fail. Despite this variability, ITS regions contain conserved secondary structural elements that facilitate comparative analyses, particularly in ITS2, which typically folds into a four-helix core structure (helices I-IV) with III being the longest and most stable. These helices represent pan-eukaryotic homologies, where base-pairing patterns are more conserved than primary , allowing reliable even among highly divergent taxa such as across metazoans and fungi. Helices I and IV, while variable in length and , contribute to species-specific signatures, whereas the overall scaffold supports phylogenetic by compensating for alignment ambiguities in primary data. In eukaryotes, ITS lengths vary by domain—for example, shorter in fungi (ITS1 ≈ 150-250 bp, ITS2 ≈ 150-200 bp) compared to longer spacers in —but the secondary structure conservation persists. Intra-genomic polymorphism within ITS arrays is generally low due to concerted evolution, a process driven by mechanisms such as unequal crossing-over and gene conversion that homogenize sequences across multiple rDNA copies on chromosomes. This homogenization minimizes intra-individual variation, ensuring that ITS sequences from a single are largely identical and representative for phylogenetic studies. However, exceptions occur in polyploids or organisms, where incomplete concerted evolution can lead to detectable polymorphisms, reflecting recent genome duplication or inter-species hybridization events that disrupt homogenization. At the boundaries of ITS regions, specific conserved motifs provide anchors for sequence delimitation and evolutionary comparisons; for example, the 5.8S-ITS2 in fungi features a highly conserved restriction site (GAA/TTC) within motif II of the 5.8S gene, which aids in distinguishing fungal sequences from other eukaryotes. This also participates in base-pairing interactions during rRNA , underscoring its structural across ascomycetes and basidiomycetes. Such motifs, while short, are invariant in many fungal clades, serving as diagnostic elements amid the surrounding spacer variability.

Biological Role in rRNA Maturation

Transcription and Processing Mechanism

In eukaryotes, the internal transcribed spacers (ITS1 and ITS2) are transcribed as part of a large precursor ribosomal RNA (pre-rRNA) by RNA polymerase I from tandemly repeated ribosomal DNA (rDNA) arrays in the nucleolus. This transcription produces a polycistronic 35S pre-rRNA in yeast (or 47S in mammals), which encompasses the 5' external transcribed spacer (5' ETS), the 18S rRNA, ITS1, the 5.8S rRNA, ITS2, the 25S rRNA (28S in mammals), and the 3' ETS. The process is tightly coupled with nascent pre-rRNA folding and assembly of ribosomal proteins and factors to form the small subunit (SSU) processome. Processing of the pre-rRNA begins co- or post-transcriptionally with endonucleolytic cleavages to remove the spacers, followed by exonucleolytic trimming to generate mature rRNAs. The initial step involves removal of the 5' ETS through cleavages at sites A0 and , directed by the U3 small nucleolar ribonucleoprotein (snoRNP), which base-pairs with the pre-rRNA to facilitate access by endonucleases such as Rnt1 in . Subsequent cleavage at site A2 within ITS1, also guided by U3 snoRNP, separates the pre-18S rRNA (20S in ) from the pre-60S intermediates, marking the separation of SSU and large subunit (LSU) biogenesis pathways; the 3' end of the 18S rRNA is later finalized by the endonuclease Nob1 in the . ITS2 excision occurs later in the 27S pre-rRNA (LSU precursor) via endonucleolytic cleavage at site , catalyzed by the Las1 endonuclease as part of the Las1-Las2 complex, which generates a 7S pre-5.8S rRNA and a pre-25S rRNA. This is followed by exonucleolytic trimming: the nuclear (including Rrp44, Rrp6, and the helicase Mtr4) degrades the remnant after 5.8S in the 7S species, while the Rat1-Rai1 trims the 3' end of the pre-25S to mature 25S rRNA; additional cytoplasmic like Ngl2 finalize the 5.8S 3' end. These steps ensure precise maturation while degrading the ITS sequences. In prokaryotes, rRNA transcription and processing differ markedly, occurring in the cytoplasm without a dedicated nucleolus and involving RNA polymerase holoenzyme with sigma factors rather than polymerase I. The primary transcript is a 30S precursor polycistron containing 16S rRNA, an intergenic spacer (analogous to ITS1), 23S rRNA, another spacer (analogous to ITS2), and 5S rRNA, often with interspersed tRNA genes. Unlike eukaryotic ITS, these prokaryotic spacers may contain regulatory sequences such as promoters for downstream operons or tRNA processing sites. Processing is rapid and initiated by the double-strand-specific endonuclease RNase III, which cleaves at stem-loop structures flanking the mature rRNA sequences to release precursor 16S and 23S rRNAs, excising the spacers as byproducts. Subsequent exonucleolytic trimming by enzymes like RNase T matures the ends, while any embedded tRNAs are processed separately by RNase P and other factors, enabling quick ribosome assembly under varying growth conditions.

Evolutionary and Functional Significance

The internal transcribed spacers (ITS) in (rDNA) exhibit evolutionary conservation primarily due to their physical linkage with essential rRNA genes, which are critical for and thus under strong purifying selection across taxa. This linkage ensures that the entire pre-rRNA transcript, including ITS regions, is maintained as a functional unit despite sequence divergence in the non-coding spacers. However, ITS sequences evolve more rapidly than the conserved rRNA coding regions, accumulating mutations that reflect lineage-specific divergences without compromising overall rDNA integrity. Such variability arises from relaxed selective pressure in the spacers, allowing them to serve as repositories for genetic changes during . Beyond their role in rRNA processing—where ITS regions form secondary structures essential for endonucleolytic cleavage—rDNA clusters containing ITS serve as hotspots for chromosomal rearrangements, facilitating unequal crossing-over and non-allelic that drive structural polymorphisms and evolution. For instance, in mammals, these hotspots contribute to copy number instability and pericentromeric repositioning, underscoring their impact on . Inter-domain comparisons highlight distinct organizational strategies: eukaryotic rDNA features tandemly arrayed repeats with multiple ITS copies per locus, enabling concerted evolution through recombination, whereas prokaryotic rRNA operons are typically dispersed across the genome with simpler intergenic spacers lacking the extensive ITS complexity. Horizontal transfer of rDNA units, including ITS, is rare but documented, for example between phylogenetically distinct grass lineages. These events can introduce variant spacers, influencing host ribosomal adaptation. In , ITS-embedded rDNA plays a key role in nucleolar dominance, where epigenetic silencing of select loci ensures balanced rRNA production amid . fluctuations, often exceeding hundreds of units per , are maintained through mechanisms like unequal sister , with ITS sequences homogenizing via concerted to preserve functional uniformity. This dynamic regulation links rDNA variability to broader adaptive processes, such as responses and hybrid incompatibility.

Applications in Molecular Identification

Phylogenetic Inference

The internal transcribed spacer (ITS) region functions as an effective marker for phylogenetic inference owing to its moderate evolutionary rate, which lies between the highly conserved ribosomal RNA (rRNA) genes and the more rapidly evolving protein-coding genes, enabling resolution of relationships at intermediate taxonomic scales such as genera and families in fungi. This positioning allows ITS to serve in multi-gene phylogenetic studies, complementing slower-evolving loci for broader evolutionary insights while providing sufficient variability for finer-scale analyses. Phylogenetic reconstruction using ITS typically begins with informed by secondary structure models, which predict folding patterns to improve positional and accuracy, particularly for the variable ITS2 subdomain. Tools like 4SALE facilitate this structure-aware alignment, followed by model-based inference methods such as maximum likelihood, often employing the General Time Reversible (GTR) with gamma-distributed rate variation across sites (GTR + G) to account for heterogeneous evolutionary rates and estimate tree topologies. ITS excels in resolving recent evolutionary divergences, such as genus-level relationships in fungal lineages, due to its high sequence variability that distinguishes closely related taxa with a success rate exceeding 70% at the genus rank. However, its utility diminishes for deep phylogenies, where rapid evolution leads to substitution saturation—multiple changes at the same sites that obscure ancient signals and complicate alignments across diverse taxa. The adoption of ITS for fungal began in the 1990s, with early applications in diversity studies and tree-building that revolutionized mycological , amassing over 172,000 sequences in public repositories by the early . Today, it remains a of eukaryotic phylogenomics, exemplified by the UNITE database, which curates reference ITS sequences clustered into hypotheses to support taxonomic communication and evolutionary analyses across fungi and other eukaryotes. As of 2024, it contains nearly 10 million ITS sequences clustered into approximately 2.4 million hypotheses.

Taxonomic Barcoding and Species Delimitation

The Internal Transcribed Spacer (ITS) region serves as the official DNA barcode marker for fungi, formally proposed and adopted in 2012 by the Fungal Barcoding Consortium under the Consortium for the Barcode of Life due to its superior discriminatory power across diverse fungal lineages. This designation was based on comprehensive evaluations showing ITS outperforms other candidates like the large subunit rRNA (LSU) and RNA polymerase II subunit (RPB2) in species identification, with a probability of correct identification (PCI) of approximately 73% in (including 71% in ) and 77% in . These success rates reflect ITS's ability to reveal a clear gap between intraspecific and interspecific variation, enabling reliable discrimination in the two largest fungal phyla, though performance can vary in less-studied groups like early-diverging fungal lineages (such as Mucoromycota). The typical workflow for ITS-based barcoding begins with from fungal specimens, followed by amplification of the core ITS region (ITS1-5.8S-ITS2) using universal primers such as ITS5 and ITS4 or ITS1F and ITS4. Amplified products are then sequenced, often via for targeted identification, and the resulting sequences are queried against public reference databases like the (BOLD) or using tools such as for similarity matching. This process facilitates rapid species assignment by aligning query sequences to vouchered references, supporting high-throughput identification in field-collected samples. For species delimitation, ITS sequences are analyzed using threshold-based approaches, where genetic similarities of 97-99% are commonly applied to cluster sequences into operational taxonomic units (OTUs), reflecting observed intraspecific variation in many fungal taxa. More sophisticated methods integrate phylogenetic information, such as the model, which recursively partitions sequences based on detected gaps in pairwise distances without requiring a tree, or the model, which uses ultrametric phylogenies to distinguish coalescent processes from events while accounting for intraspecific polymorphism. These integrative techniques enhance of cryptic species, particularly in complexes with low interspecific divergence. ITS barcoding finds extensive application in mycological surveys to catalog fungal in ecosystems like forests and soils, where it aids in documenting overlooked . In , it is pivotal for identifying plant s, enabling early detection and management of diseases caused by fungi such as or Botrytis species through sequence matching to pathogen databases. Beyond fungi, ITS has been extended as a supplementary in select algae, such as dinoflagellates and , where it complements markers like rbcL for resolving closely related taxa, and in certain like nematodes, supporting in parasitic or soil-dwelling contexts.

Methodological Considerations

Sequencing Techniques

The sequencing of internal transcribed spacer (ITS) regions begins with DNA extraction from diverse biological sources, such as fresh tissues, herbarium specimens, or environmental samples like soil and water. For herbarium specimens, which often contain degraded DNA due to age and preservation methods, modified cetyltrimethylammonium bromide (CTAB) protocols or commercial kits like the DNeasy Plant Mini Kit are commonly employed to yield sufficient quantities for downstream amplification, with success rates improving when using silicon dioxide-based purification to remove inhibitors. Environmental DNA (eDNA) extraction typically involves kits optimized for low-biomass samples, such as the PowerSoil Kit, followed by concentration steps to enhance recovery from complex matrices. Amplification of ITS regions is achieved through (PCR) using taxon-specific primers. In eukaryotes, particularly fungi, the forward primer ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and reverse primer ITS4 (5'-TCCTCCGCTTATTGATATGC-3') target the ITS1, 5.8S rRNA, and ITS2 regions, producing amplicons of approximately 600-800 base pairs depending on the species. These primers, originally designed for fungal , exhibit broad universality across eukaryotic groups due to conserved flanking sequences in the small and large subunit rRNA genes. For prokaryotes, primers such as 1406f (5'-TGYACACACCGCCCGT-3') and 23Sr (5'-GGGTTBCCCCATTCRG-3') amplify the 16S-23S ITS region, which varies in length from 200-600 base pairs and includes tRNA genes, enabling species-level resolution in . PCR reactions employ high-fidelity DNA polymerases, such as Phusion or Q5, to minimize errors during amplification, with standard conditions including an initial denaturation at 98°C for 30 seconds, followed by 30-35 cycles of denaturation at 98°C for 10 seconds, annealing at 50-55°C for 30 seconds, and extension at 72°C for 30-60 seconds, concluding with a final extension at 72°C for 5 minutes. Following PCR, sequencing approaches vary by application scale. For targeted sequencing of individual samples or clones, Sanger sequencing is preferred, providing high-accuracy reads up to 1000 base pairs directly from purified PCR products, often using the same ITS1 and ITS4 primers for cycle sequencing. In metagenomic studies, next-generation sequencing (NGS) platforms like the Illumina MiSeq are widely used, generating millions of short reads (250-500 base pairs) from barcoded amplicon libraries to profile diverse communities; demultiplexing is performed post-sequencing using index sequences to assign reads to samples. This NGS method supports high-throughput analysis but requires careful library preparation to avoid biases from primer mismatches in variable ITS regions.

Analysis Challenges and Best Practices

Analysis of internal transcribed spacer (ITS) sequences presents several computational and interpretive challenges that can compromise the accuracy of fungal identification and community profiling. One major issue is the formation of chimeric sequences during amplification, which arise from template switching and can lead to artificial recombinants mimicking novel taxa. These chimeras are particularly prevalent in high-diversity environmental samples and can inflate diversity estimates if undetected. Another challenge is intra-genomic variability within the multi-copy rDNA , where concerted evolution is incomplete, resulting in sequence polymorphisms that may represent true biological variation or sequencing artifacts, complicating species delimitation. Additionally, incompleteness in reference databases, such as UNITE, hinders taxonomic assignment, as many fungal lineages lack representative sequences, leading to unclassified operational taxonomic units (OTUs) or misassignments. To address these challenges, best practices emphasize rigorous preprocessing and . Chimeras can be detected and removed using algorithms like UCHIME, which outperforms earlier methods in sensitivity for and reference-based detection, especially in noisy datasets. Intra-genomic variability is mitigated through of PCR products for or by employing long-read technologies like PacBio or Oxford Nanopore, which resolve full operons and haplotypes without amplification biases. For next-generation sequencing (NGS) data, error correction pipelines such as DADA2 model substitution and indel errors to infer amplicon sequence variants (ASVs) at single-nucleotide resolution, reducing false positives from polymerase errors. Structure-based alignment improves handling of the variable ITS regions; tools like ITSx extract ITS1, 5.8S, and ITS2 subregions using Markov models trained on conserved flanking sequences, enhancing alignment accuracy over generic methods. is then performed with software such as MAFFT, which employs for rapid, high-quality alignments of divergent ITS sequences. Comprehensive pipelines like QIIME 2 integrate these steps, including primer trimming and taxonomic assignment, tailored for fungal ITS via plugins like ITSxpress. For OTU-based approaches, clustering at 97% sequence remains a standard threshold for fungal ITS, balancing species-level resolution with over-splitting due to variability, as validated in diverse ascomycete lineages. In , homopolymers—common in ITS2—pose interpretation difficulties due to polymerase slippage, manifesting as ambiguous peaks in chromatograms; these are resolved by sequencing both strands and manually verifying base calls beyond the repeat . Quality metrics ensure reliability: sequences should exceed 500 base pairs in length to cover the full ITS adequately, with Phred scores >Q20 across 80% of bases, and all data linked to vouchered specimens for and validation against morphological traits. Adhering to these practices minimizes artifacts and supports robust downstream applications in fungal and .

References

  1. [1]
    Nuclear ribosomal internal transcribed spacer (ITS) region ... - PNAS
    Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the ...Missing: applications | Show results with:applications
  2. [2]
    Internal Transcribed Spacer - an overview | ScienceDirect Topics
    The internal transcribed spacer (ITS) is part of the rDNA array and lies between the SSU rDNA and the LSU rDNA coding regions. It is divided into ITS1 and ITS2, ...
  3. [3]
    Pan-eukaryote ITS2 homologies revealed by RNA secondary structure
    Internal transcribed spacers. The term ITS traditionally refers to the entire region between the nuclear genes for the ribosomal small subunit (SSU) and the ...Results · Table 1 · Internal Transcribed Spacers
  4. [4]
    ITSoneDB: a comprehensive collection of eukaryotic ribosomal RNA ...
    Sep 25, 2017 · ITSoneDB: a comprehensive collection of eukaryotic ribosomal RNA Internal Transcribed Spacer 1 (ITS1) sequences Open Access. Monica ...
  5. [5]
    assessment of ITS1 and ITS2 Illumina sequencing using multiple ...
    Aug 6, 2025 · The ITS1 region is located between the 18S and the 5.8S rRNA genes and is typically 150–400 bp long, while the ITS2 region is located between ...
  6. [6]
    Use of ITS2 Region as the Universal DNA Barcode for Plants and ...
    We propose that the ITS2 locus should be used as a universal DNA barcode for identifying plant species and as a complementary locus for CO1 to identify animal ...
  7. [7]
    Nuclear ribosomal internal transcribed spacer (ITS) region as ... - NIH
    Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the ...
  8. [8]
    Multiple Ribosomal RNA Operons in Bacteria; Their Concerted ...
    In bacteria, the 5S, 16S, and 23S rRNA genes are organized into a gene cluster linked together by internal transcribed spacer (ITS) regions containing tRNAs ...
  9. [9]
    The Lifecycle of Ribosomal RNA in Bacteria - NCBI
    Located at the 5' and 3' end of the operon are conserved external transcribed spacers (5'-ETS and 3'-ETS), and an internal transcribed spacer (ITS) separates ...<|control11|><|separator|>
  10. [10]
    Unlinked rRNA genes are widespread among bacteria and archaea
    Ribosomes are essential to cellular life and the genes for their RNA components are the most conserved and transcribed genes in bacteria and archaea.
  11. [11]
    Is the 16S–23S rRNA Internal Transcribed Spacer Region a Good ...
    In the most common pattern, the 23S and 5S genes form an operon, and the 16S rRNA gene is separate; there may be one or more than one copy of each of the genes.
  12. [12]
    Differential Regulation of rRNA and tRNA Transcription from the ...
    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in ...
  13. [13]
    Divergence and Redundancy of 16S rRNA Sequences in Genomes ...
    The three rRNAs, namely 16S, 23S, and 5S rRNAs, are typically linked together into an operon, which frequently contains an internal transcribed spacer and at ...
  14. [14]
    Ribosome Biogenesis in Archaea - Frontiers
    Most euryarchaeota have a typically bacterial operon organization with the 16S-23S-5S rRNA genes linked in this order, separated by spacer sequences, and ...Abstract · rRNA Organization, Synthesis... · Ribosomal RNA Modifications
  15. [15]
    rrnDB: documenting the number of rRNA and tRNA genes in ...
    Two organisms with 15 rrn operons are know—Clostridium paradoxum and Photobacterium profundum. The range of rrn genes in archaea is smaller, with one to four ...
  16. [16]
    Molecular typing of Mycobacterium avium isolates by sequencing of ...
    The nucleotide sequence of the variable 16S-23S rDNA internal transcribed spacer (ITS) was determined in 32 strains of Mycobacterium avium, including 29 ...
  17. [17]
    The role of internal transcribed spacer 2 secondary structures in ...
    The internal transcribed spacer region is the preferred DNA barcode for fungi. However, inter- and intra-specific distances in ITS sequences highly vary among ...
  18. [18]
    Evaluation of the ribosomal DNA internal transcribed spacer (ITS ...
    Oct 25, 2018 · GC content of ITS1 and ITS2 in different groups. The GC content of the ITS2 sequences was significantly higher than that of the ITS1 ...
  19. [19]
    A Conserved Sequence in Internal Transcribed Spacer 1 of Plant ...
    The rest of ITS1 is highly variable in sequence. Therefore, the conserved motif within ITS1 may have a key function in the processing of rRNA gene transcripts.Missing: flanked splice
  20. [20]
    Secondary structure models of the nuclear internal transcribed ... - NIH
    The number of unpaired loop bases appears to be rather conserved in the ITS2 transcript (approximately 40–45), while it varies in ITS1 (26–62). Probably a ...
  21. [21]
    Ribosomal internal transcribed spacer 2 (ITS2) exhibits a common ...
    We then identified structural features conserved among vertebrates through comparative analysis at the secondary structure level in fish, two amphibians, a bird ...
  22. [22]
    https://pmc.ncbi.nlm.nih.gov/articles/PMC1370725/
  23. [23]
    Applying an internal transcribed spacer as a single molecular ...
    Aug 22, 2023 · Particularly, the ITS2 DNA region exhibited a higher identification efficiency than the ITS1 region due to its greater interspecific variation.
  24. [24]
    A common core of secondary structure of the internal transcribed ...
    Recently, the use of the internal transcribed spacer 2 (ITS2) sequence was suggested, as it shows a high divergence in sequence with an assumed conservation in ...
  25. [25]
    Concerted Evolution of the Internal Transcribed Spacer of Nuclear ...
    DNA sequence homogenization via concerted evolution is driven by two molecular processes, gene conversion and unequal crossing over. The relative ...
  26. [26]
    Lack of ITS sequence homogenization in Erysimum species ... - Nature
    Oct 7, 2022 · Concerted evolution is particularly notable in multicopy nuclear genes, where homogenization is mainly achieved by unequal crossing over and ...Its1 And Its2 Amplification · Results · Discussion
  27. [27]
    Intragenomic rDNA variation - the product of concerted evolution ...
    Jul 4, 2023 · Recombination, including unequal crossing-over, can result in one recombinant chromosome having more rDNA copies and the other fewer copies.
  28. [28]
    ITS1, 5.8S and ITS2 secondary structure modelling for intra-specific ...
    23-Nov-2014 · Motifs that are evolutionarily conserved among eukaryotes were found for all ITS1, 5.8S and ITS2 sequences. The sequences exhibited conserved ...
  29. [29]
    Evolutionarily conserved structural features in the ITS2 of ...
    The first complementarity involves the 5.8S-ITS2 junction and 13 nt at the 5′ end of U8, whereas the other one occurs between a mature 28S rRNA segment known to ...
  30. [30]
    An overview of pre-ribosomal RNA processing in eukaryotes - PMC
    The U3 snoRNA plays a central role in 5′-ETS processing by hybridizing with distant segments of the pre-rRNA and chaperoning RNA folding,26,48–51 which was ...
  31. [31]
    RNase III Cleaves Eukaryotic Preribosomal RNA at a U3 snoRNP ...
    Apr 5, 1996 · The U3 small nucleolar ribonucleoprotein functions in the first step of pre-ribosomal RNA processing. Cell, 60 (1990), pp. 897-908. View PDF ...
  32. [32]
    Reconstitution of the complete pathway of ITS2 processing at the pre ...
    Nov 27, 2017 · This complicated process starts in the nucleolus with transcription of a large ribosomal RNA precursor, called 35S in yeast and 47S pre-rRNA ...
  33. [33]
    RNase III: Genetics and Function; Structure and Mechanism - PMC
    RNase III is a global regulator of gene expression in Escherichia coli that is instrumental in the maturation of ribosomal and other structural RNAs.
  34. [34]
    Secondary Structure Analyses of the Nuclear rRNA Internal ...
    The internal transcribed spacers of the nuclear ribosomal RNA gene cluster, termed ITS1 and ITS2, are the most frequently used nuclear markers for phylogenetic ...Missing: occurrence | Show results with:occurrence
  35. [35]
    Evolution of the secondary structure of the rRNA internal transcribed ...
    Apr 2, 2002 · The ITS2 of hard ticks ranges in size from 679 bp (I. scapularis) to 1547 bp (Ap. concolor); the ITS2 of the latter is the largest ITS2 known.Dna Amplification And... · Sequence Analysis · Results
  36. [36]
    Regulatory Elements for Expression of Ribosomal RNA Genes
    Jun 2, 2025 · Regulatory elements for expression of ribosomal RNA genes resides in the (1) transcribed spacer region (2) non-transcribe spacer region (3) 5' flanking region.Regulatory Elements For... · Detailed Explanation · Summary Table
  37. [37]
    Are ribosomal DNA clusters rearrangement hotspots? A case study ...
    May 13, 2011 · Several studies have shown a significant association between breakpoint reuse and centromere repositioning in different mammalian groups such as ...
  38. [38]
    Human rRNA Gene Clusters Are Recombinational Hotspots in Cancer
    In summary, we have detected structural alterations to the rRNA gene clusters in over 50% of the adult solid tumors examined, making these genomic ...
  39. [39]
    The Dynamic Interplay Between Ribosomal DNA and Transposable ...
    The rDNAs represent heavily transcribed units along the chromosomes. These actively transcribed 35S/45S rDNA loci constitute the nucleolus organizer regions ( ...Ribosomal Dnas And... · Ribosomal Dnas: Conserved... · Tes In Ribosomal Dna
  40. [40]
    Multiple horizontal transfers of nuclear ribosomal genes ... - PNAS
    Jan 30, 2017 · At least nine independent transfers of panicoid DNA into Hordeum seem to have occurred, confirming that the transfer of exotic DNA is not an isolated event.
  41. [41]
    Mechanisms of rDNA copy number maintenance - PMC - NIH
    Nucleolar dominance is a phenomenon, where a subset of rDNA loci is actively transcribed, whereas the other loci are silenced. Although nucleolar dominance was ...
  42. [42]
    Concerted copy number variation balances ribosomal DNA dosage ...
    Here we show that variation in the 5S and 45S rDNA arrays is tightly coupled, despite their location on different chromosomes.Sign Up For Pnas Alerts · Results · Rdna 5s And 45s Genes...<|control11|><|separator|>
  43. [43]
    Nucleolar dominance: a model for rRNA gene silencing
    Nucleolar dominance provides a powerful model for analyzing dosage compensation by biochemical approaches, since the rRNA genes and transcripts from each ...
  44. [44]
    ITS2 sequence–structure analysis in phylogenetics: A how-to ...
    Based on these tools, we describe how to utilize ITS2 sequence and secondary structure information together with an ITS2 specific scoring matrix and an ITS2 ...Review · Abstract · Introduction
  45. [45]
    Assessing the Applicability of the GTR Nucleotide Substitution ... - NIH
    The General Time Reversible (GTR) model of nucleotide substitution is at the core of many distance-based and character-based phylogeny inference methods.
  46. [46]
    Are similarity‐ or phylogeny‐based methods more appropriate for ...
    Aug 2, 2011 · The internal transcribed spacer (ITS) of the nuclear ribosomal DNA region is a widely used species marker for plants and fungi.
  47. [47]
    A Consistent Phylogenetic Backbone for the Fungi - PMC - NIH
    Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology.
  48. [48]
    The UNITE database for molecular identification and taxonomic ...
    Nov 11, 2023 · UNITE (https://unite.ut.ee) is a web-based database and sequence management environment for molecular identification of eukaryotes. It targets ...Abstract · Databases · The UNITE website · Outlook
  49. [49]
    Determining threshold values for barcoding fungi: lessons from ...
    Feb 28, 2016 · A threshold value of 99% is suitable for distinguishing species in the majority of lineages in the genus using the entire ITS region but only 90 ...
  50. [50]
    ABGD, Automatic Barcode Gap Discovery for primary species ...
    Aug 29, 2011 · An integrative approach to species discovery in odonates: from character-based DNA barcoding to ecology. Molecular Ecology, 19, 3881–3893.
  51. [51]
    DNA-Barcoding Identification of Plant Pathogens for Disease ...
    This chapter provides a detailed protocol for the isolation of genomic DNA of fungal and oomycete pathogens from fresh field samples.
  52. [52]
    DNA barcoding species in Alexandrium tamarense complex using ...
    As such ITS has the potential to serve as unique species-specific “DNA barcode” for most dinoflagellates. However, the suitability of ITS for resolving species ...
  53. [53]
    Ancient DNA extraction methods for herbarium specimens
    Studies of herbarium material aiming to sequence single markers (e.g., ITS) used the standard cetyltrimethylammonium bromide (CTAB) protocol for DNA extraction ...Plant Materials · Dna Yield · Ngs Results
  54. [54]
    DNA Extraction from Herbarium Specimens
    Although many methods have been developed for extraction of DNA from herbarium specimens, the most frequently used are modified CTAB and DNeasy Plant Mini Kit ...
  55. [55]
    DNA extraction, PCR amplification, and sequencing of the ITS2 ...
    Jul 14, 2025 · Total genomic DNA from the herbarium specimen was extracted using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with a modification. 2.1.
  56. [56]
    Fungal-specific PCR primers developed for analysis of the ITS ... - NIH
    The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species ...
  57. [57]
    Use of the ITS primers, ITS1F and ITS4, to characterize fungal ...
    Based on our results, and a search of the GenBank database, amplicons of the ITS1F and ITS4 primer set exhibit considerable variability (420 to 825 bp), but due ...
  58. [58]
    White, T. J., T. D. Bruns, S. B. Lee, and J. W. Taylor. Amplification ...
    White, T. J., T. D. Bruns, S. B. Lee, and J. W. Taylor. Amplification and direct sequencing of fungal ribosomal RNA Genes for phylogenetics. January 1990. In ...
  59. [59]
    Detection of eight foodborne bacterial pathogens by oligonucleotide ...
    16SF: (5′CGCTGGCGGCAGGCCTAACACATGCGCGGCTGCTGGCACGGAGTTAGCC3′) 16SR: (5 ... 23SR: (5′AGGATGTTGGCTTAGAAGCAGCGCTACCTTAGGACCGTTATAGTTAC 3′). The forward ...
  60. [60]
    A systematic assessment of automated ribosomal intergenic spacer ...
    ... 16SF: 5′-GYACACACCGCCCGT-3′ and 23SR: 5′-GGTTBCCCCATTCRG-3 ... We suggest such an improved 23SR primer with the following sequence: 5′-RGTTBYCYCATTCRG-3′.
  61. [61]
    Comparison and Validation of Some ITS Primer Pairs Useful for ...
    The full ITS region in fungi has an average length of 500 and 600 base pairs (bp) for ascomycetes and basidiomycetes, respectively, and an average length of 600 ...<|control11|><|separator|>
  62. [62]
    ITS Illumina Amplicon Protocol - Earth Microbiome Project
    Run amplicons from each sample on an agarose gel. Expected band size for ITS1f-ITS2 is ~230 bp. Low-biomass samples may yield faint or no visible bands; ...
  63. [63]
    Next-Generation Sequencing (NGS) | Explore the technology - Illumina
    The MiSeq i100 Series introduces index-first sequencing to Illumina NGS technology, offering faster demultiplexing and real-time run management. This ...Illumina Sequencing Methods · History of Illumina Sequencing · NGS for Beginners
  64. [64]
    ITS as an environmental DNA barcode for fungi - BMC Microbiology
    Jul 9, 2010 · The internal transcribed spacer (ITS) of nuclear DNA (nrDNA) is the preferred DNA barcoding marker both for the identification of single taxa ...Primer Mismatches In... · Taxonomic Bias For Different... · Discussion
  65. [65]
    UCHIME improves sensitivity and speed of chimera detection - PMC
    To improve speed and accuracy of chimera detection, we created a new algorithm, UCHIME. In our tests, UCHIME achieved higher sensitivity than the best previous ...
  66. [66]
    Critical Issues in Mycobiota Analysis - Frontiers
    Feb 13, 2017 · ITS sequences show a high degree of intraspecific variation (Figures 1D,E), which leads to the introduction of gaps during the alignment process ...<|separator|>
  67. [67]
    Intragenomic variation in nuclear ribosomal markers and its ...
    At the intraspecific level, rDNA is believed to be under concerted evolution and the internal transcribed spacers (ITS) region is actually accepted as ...
  68. [68]
    Unambiguous identification of fungi: where do we stand and how ...
    Jul 10, 2020 · Here we provide a conceptual framework for the identification of fungi, encouraging the approach of integrative (polyphasic) taxonomy for species delimitation.
  69. [69]
    Single Strain High-Depth NGS Reveals High rDNA (ITS-LSU ...
    Feb 2, 2021 · The use of an innovative NGS technique allowed the high-throughput high-depth sequencing of the ITS1-LSU D1/D2 amplicons of 252 strains belonging to four ...
  70. [70]
    Improved software detection and extraction of ITS1 and ITS2 from ...
    Jul 19, 2013 · The nuclear ribosomal internal transcribed spacer (ITS) region is the primary choice for molecular identification of fungi.
  71. [71]
    Mastering DNA chromatogram analysis in Sanger sequencing ... - NIH
    Nov 13, 2023 · This overview sheds light on prominent technical concerns that can emerge prior to and during the interpretation of DNA chromatograms in Sanger sequencing.
  72. [72]
    https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0068535