Fact-checked by Grok 2 weeks ago

Transfer DNA

Transfer DNA (T-DNA) is a defined segment of DNA, approximately 5–10% of the tumor-inducing (Ti) plasmid in the bacterium Agrobacterium tumefaciens, that is mobilized and transferred as a single-stranded form into the nucleus of susceptible plant cells during a natural horizontal gene transfer process.^[1] This transfer enables the stable integration of T-DNA into the plant genome, where it expresses bacterial genes that alter plant physiology.^[2] In its native context, T-DNA carries oncogenes that induce the formation of crown gall tumors on infected plants, along with genes for opine synthesis that provide nutrients to the bacterium.^[3] The structure of T-DNA is delimited by two 25-base-pair imperfect direct repeat sequences known as the left border (LB) and right border (RB), which serve as recognition sites for the initiation of transfer.^[1] The VirD1/VirD2 endonuclease complex specifically nicks the bottom strand of the Ti plasmid at these borders—between nucleotides 3 and 4—releasing the T-strand while covalently attaching VirD2 to its 5' end.^[3] The single-stranded T-DNA is then coated by VirE2 proteins to form a protective T-complex, which is exported from the bacterium through a type IV secretion system encoded by virulence (vir) genes on the Ti plasmid.^[1] Once inside the plant cell, the T-complex traffics to the nucleus via a piggyback mechanism involving host proteins.^[3] VirD2 acts as a nuclear localization signal (NLS)-bearing pilot protein, binding to plant karyopherin α (e.g., AtKAPα) to facilitate import through nuclear pores, while VirE2 relies on the host adaptor protein VIP1 for its entry.^[3] Integration into the plant genome occurs randomly through illegitimate recombination, often at sites of double-strand breaks, potentially involving host DNA repair pathways like non-homologous end joining.^[2] This process can result in polar insertion, with the RB-proximal end integrating more frequently than the LB-proximal end.^[3] Beyond its role in pathogenesis, T-DNA has been harnessed as a cornerstone of plant biotechnology since the 1980s, where disarmed Ti plasmids or binary vector systems separate T-DNA from vir genes to deliver desired transgenes without oncogenic effects.^[1] These systems, such as the pBIN series, allow precise insertion of genes for traits like herbicide resistance or pest protection, enabling the creation of genetically modified crops used worldwide.^[1] Ongoing research explores T-DNA's integration mechanisms to improve transformation efficiency and reduce off-target effects in diverse plant species.^[2]

Overview

Definition and Key Characteristics

Transfer DNA (T-DNA) is a defined segment of approximately 20-25 kilobases (kb) within the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens or the root-inducing (Ri) plasmid of Agrobacterium rhizogenes, which is mobilized from the bacterium and integrated into the nuclear genome of eukaryotic host cells, predominantly plants.^[4] This transfer process enables the bacterium to genetically modify the host, with the T-DNA serving as the mobile genetic element responsible for such transformations.^[3] Key characteristics of T-DNA include its demarcation by two 25-base-pair (bp) direct repeats known as the right border (RB) and left border (LB), which define the boundaries for excision and transfer from the plasmid.^[3]^[5] During mobilization, T-DNA is processed into a single-stranded form, termed the T-strand, which is coated with protective proteins for delivery into the host cell.^[6] In wild-type Ti plasmids, such as the octopine type, the T-DNA typically consists of two regions—TL-DNA (~13 kb) and TR-DNA (~7.8 kb)—totaling around 21 kb, while nopaline-type Ti plasmids feature a single contiguous T-DNA of similar length; Ri plasmid T-DNAs exhibit comparable sizes and structural features.^[4] In its native configuration, T-DNA encodes genes that promote opine synthesis—nutrients utilized by the bacterium—and plant hormone production, including oncogenes such as iaaH and iaaM for auxin biosynthesis, ipt for cytokinin production, and nos for nopaline synthase in Ti plasmids; analogous genes in Ri plasmids, like those in the rol family, drive root-inducing effects.^[7]^[8] These components underscore T-DNA's role as a versatile vector for interkingdom gene transfer.^[9]

Biological Role in Nature

Transfer DNA (T-DNA) plays a central role in the pathogenic lifestyle of Agrobacterium species, particularly A. tumefaciens and A. rhizogenes, by facilitating interkingdom DNA transfer that disrupts host plant physiology to the bacterium's benefit. In natural infections, T-DNA is mobilized from the bacterium's Ti (tumor-inducing) or Ri (root-inducing) plasmid and integrated into the plant's nuclear genome at wound sites, where plant-derived phenolic compounds such as acetosyringone are released and sensed by the bacterial VirA sensor kinase, activating the virulence cascade. This integration leads to the expression of T-DNA-encoded oncogenes, including iaaM and iaaH for auxin biosynthesis and ipt for cytokinin production, which cause hormonal imbalances that trigger uncontrolled cell proliferation and dedifferentiation. In A. tumefaciens infections, this manifests as crown galls—woody tumors typically forming at the plant's crown or roots—while A. rhizogenes induces hairy root disease, characterized by prolific root outgrowths.^[10] These pathological structures create a nutrient-rich niche for the bacterium, sustaining its population in the soil-plant interface.^[11] The tumors induced by T-DNA integration serve an ecological purpose by producing opines, specialized metabolites that act as exclusive carbon and nitrogen sources for the infecting Agrobacterium strain. Genes within the T-DNA, such as nos for nopaline synthase or ags for agropine synthase, direct the synthesis of these amino acid-sugar conjugates, which are catabolized by plasmid-encoded operons in the bacterium but ignored by competitors. For instance, nopaline-type Ti plasmids yield nopaline, while agropine-type Ri plasmids produce agropine, both of which enhance bacterial chemotaxis, growth, and persistence within the gall tissue, thereby securing a competitive advantage in the rhizosphere.^[10] This opine-based mutualism underscores T-DNA's role in transforming the host into a dedicated nutrient factory, promoting bacterial survival and potential dissemination through tumor fragments or infected soil.^[11] Agrobacterium's host range for T-DNA transfer is broad but biased toward dicotyledonous plants, with efficient tumor formation observed in species like tomato, sunflower, and apple, though laboratory methods have enabled T-DNA transfer and transformation in monocots such as maize and rice.^[10] Infections are opportunistic, exploiting mechanical wounds that expose susceptible cells and release wound signals, limiting spread to damaged tissues in the wild. Evolutionarily, T-DNA represents a natural vector for horizontal gene transfer from bacteria to eukaryotes, with fossilized integrations (cellular T-DNA or cT-DNA) detected in diverse plant lineages, including multiple Nicotiana species and Linaria vulgaris.^[12] These ancient transfers, often from A. rhizogenes-like ancestors, have introduced functional genes (e.g., rol loci influencing root morphology and stress responses) that may confer adaptive traits like drought tolerance or altered microbial interactions, thereby contributing to plant genome diversification and speciation over millions of years.^[12]

History

Discovery in Agrobacterium

The crown gall disease, characterized by tumor-like growths at the base of infected plants, was first documented in 1907 by Erwin F. Smith and C.O. Townsend, who isolated a bacterium from galls on chrysanthemums and demonstrated its ability to induce similar tumors upon inoculation, marking the initial recognition of a bacterial etiology for plant tumors.^[13] In the 1940s and 1950s, researchers including Armin C. Braun advanced the understanding of the causal agent, confirming Agrobacterium tumefaciens (previously named Bacterium tumefaciens and reclassified in 1942) as the primary pathogen responsible for crown gall through studies showing that bacterial infection triggers a stable, heritable transformation in plant cells, independent of ongoing bacterial presence after initial tumor formation. During the 1960s, Brian Watson and colleagues identified large extrachromosomal plasmids in virulent strains of A. tumefaciens, laying the groundwork for linking these elements to pathogenicity.^[14] In 1974, N. van Larebeke and co-workers provided definitive evidence that a large plasmid, later termed the Ti (tumor-inducing) plasmid, is essential for the bacterium's virulence, as strains cured of this plasmid lost their ability to induce tumors, while reintroduction restored it. The key breakthrough in identifying transfer DNA (T-DNA) came in the 1970s, when Mary-Dell Chilton, Michael Drummond, and their colleagues in 1977 used Southern blotting—a newly developed technique—to demonstrate that specific fragments of bacterial plasmid DNA integrate stably into the plant nuclear genome during infection, establishing T-DNA as the transforming principle carried by the Ti plasmid that drives crown gall tumorigenesis.^[15]

Evolution as a Biotechnology Tool

The transition of transfer DNA (T-DNA) from a pathogenic agent causing crown gall disease to a fundamental tool in plant biotechnology began in the late 1970s and early 1980s, when researchers engineered disarmed Ti plasmids by excising oncogenes responsible for tumor formation. This modification allowed Agrobacterium tumefaciens to transfer foreign DNA into plant genomes without inducing uncontrolled growth, enabling the stable insertion of non-oncogenic genes. A seminal example is the work by Hoekema et al. in 1983, who constructed disarmed Ti plasmids that were transferable between Escherichia coli and Agrobacterium, facilitating easier genetic manipulation and the creation of normal transgenic plants. Building on this, binary vector systems emerged in the 1980s as a major advancement, separating the T-DNA region from the virulence (vir) genes on the Ti plasmid to simplify cloning and increase transformation efficiency. In these systems, the T-DNA is housed on a small, independently replicating plasmid, while vir genes remain on a separate helper plasmid, allowing for more straightforward insertion of genes of interest and broader host compatibility. Hoekema et al. (1983) described one of the first such binary strategies, which by the 1990s became widely adopted for transforming model plants like Arabidopsis thaliana due to their versatility and reduced size constraints.^[1] Key milestones marked the practical evolution of T-DNA as a biotechnology tool. In 1985, Horsch et al. reported the first stable transgenic tobacco plants regenerated from leaf discs transformed via Agrobacterium, demonstrating efficient gene transfer and expression without tumor formation. The 2000s saw expansion to recalcitrant cereals, with protocols for maize, rice, and wheat achieving routine transformation efficiencies through optimized binary vectors and tissue culture methods. Post-2010, T-DNA integration advanced further by combining it with site-specific nucleases; for instance, 2013 studies utilized TALENs delivered via T-DNA to enable targeted mutagenesis in maize, paving the way for precise genome editing in crops.^[16] Since the mid-2010s, T-DNA systems have been pivotal in delivering CRISPR/Cas9 components for targeted genome editing in crops, enhancing precision beyond TALENs.^[17]

Molecular Structure

T-DNA Sequence and Borders

The transfer DNA (T-DNA) of Agrobacterium tumefaciens Ti plasmids consists of a mobile genetic segment typically spanning approximately 20 kb, defined by two flanking 25-bp imperfect direct repeats known as the right border (RB) and left border (LB).^[18] These borders demarcate the transferable portion, with the native T-DNA containing genes for opine biosynthesis (e.g., nopaline or octopine synthase), auxin production (iaa genes), and cytokinin production (cyt genes), all of which lack bacterial promoters and are expressed only after integration into the plant genome using host regulatory elements.^[7] The RB sequence, such as TGACAGGATATATTGGCGGGTAAAC in nopaline-type plasmids, is critical for initiating single-stranded nicking and transfer, while the LB ensures proper termination.^[19] The border structures facilitate site-specific processing by the VirD1/VirD2 endonuclease complex, which binds to and cleaves the bottom strand at the borders to generate the transferable T-strand.^[20] Specifically, the RB includes a core VirD2 binding site essential for nicking between the third and fourth nucleotides from the 5' end, with an adjacent overdrive sequence (a ~12-bp motif rich in cyclopurine) that enhances cleavage efficiency by recruiting VirC1 protein.^[21] In contrast, the LB is less critical for initiation but plays a key role in terminating transfer to avoid read-through into non-T-DNA plasmid regions, although imperfect termination can occur, leading to vector backbone integration in some cases.^[22] The borders exhibit high sequence similarity (about 93% identity) but are imperfect, with the RB being more active in promoting transfer polarity.^[23] T-DNA size and composition vary across plasmid types. Nopaline-type Ti plasmids feature a single contiguous T-DNA of ~25 kb, while octopine-type Ti plasmids have two separate regions: a larger TL-DNA (~13 kb) and a smaller TR-DNA (~7.8 kb).^[4] Ri plasmids from Agrobacterium rhizogenes, responsible for hairy root disease, contain T-DNA regions totaling 15-30 kb, including TL-DNA (~18 kb) with rol genes for root induction and variable TR-DNA (5-28 kb) with agropine synthesis genes.^[24] In engineered systems, minimal T-DNAs have been developed for biotechnology, reducing the construct to 1-2 kb by retaining only the borders and a multiple cloning site for foreign gene inserts, eliminating native oncogenes to enable non-tumorigenic transformation.^[25]

Virulence Region and Plasmid Components

The Ti and Ri plasmids of Agrobacterium tumefaciens and Agrobacterium rhizogenes, respectively, are large conjugative plasmids typically around 200 kb in size that enable the transfer of T-DNA to plant cells. These plasmids are partitioned into the transferable T-DNA region and a non-transferable virulence (vir) region, along with other elements supporting plasmid maintenance and bacterial conjugation. The vir region, spanning approximately 35 kb in Ti plasmids and about 30 kb in Ri plasmids, contains the core genetic machinery for T-DNA mobilization without being transferred itself.^[4]^[26] The vir region is organized into six major operons—virA, virB, virC, virD, virE, and virG—that encode proteins essential for sensing plant signals, processing T-DNA, and exporting it via a specialized secretion apparatus. The virA and virG operons form a two-component regulatory system: VirA acts as a transmembrane sensor kinase that detects phenolic compounds and sugars from wounded plants, autophosphorylating to activate VirG, the response regulator that binds to vir box promoters to induce expression of the other vir operons. The virB operon, the largest, encodes 11 proteins (VirB1–VirB11) that assemble the type IV secretion system (T4SS), including a pilus for cell-to-cell contact, an ATPase (VirB11) for energy, and a translocation channel that exports T-DNA and effector proteins into host cells. The virC operon produces VirC1 and VirC2, which bind upstream of the T-DNA borders at the overdrive sequence to enhance nicking efficiency and stabilize the relaxosome complex. In the virD operon, VirD1 functions as a site-specific endonuclease that, with VirD2, cleaves the T-DNA at its borders to generate the single-stranded T-strand; VirD2 covalently attaches to the 5' end, serving as a pilot protein for export and aiding nuclear targeting in the plant cell. The virE operon encodes VirE2, a single-strand DNA-binding protein that coats the exported T-strand to protect it from degradation and facilitate its transport through the T4SS and into the plant nucleus. Some Ti and Ri plasmids also include a virF or virH operon encoding additional effectors that modulate host responses.^[4]^[26]^[27] Beyond the vir region, Ti and Ri plasmids feature components for autonomous replication and interbacterial transfer. The origin of transfer (oriT) is located within the conjugative tra region, where it serves as the nicking site for plasmid mobilization during bacterial conjugation, processed by relaxase proteins like TraA from the MOBQ family. Replication is controlled by the repABC cassette: repA and repB handle plasmid partitioning and stability, while repC encodes the initiator protein that binds the plasmid origin of vegetative replication (oriV) to maintain low copy number in the bacterium. The tra and trb regions, spanning over 60 kb and regulated by quorum-sensing via TraR and autoinducer molecules, encode the full conjugative apparatus, including mating bridge proteins and surface exclusion factors, allowing horizontal transfer of the entire plasmid between agrobacteria. These elements ensure the plasmid's persistence and dissemination in soil environments.^[4]^[28]^[29]

Mechanism of Transfer

Initiation and Activation in Natural Infection

In natural infections, the initiation of T-DNA transfer by Agrobacterium tumefaciens begins with the detection of host-derived signals at plant wound sites, where phenolic compounds such as acetosyringone are released from damaged cells. The Ti plasmid-encoded VirA protein, a transmembrane sensor kinase, specifically binds these low-molecular-weight phenolics, triggering a conformational change that leads to its autophosphorylation on a conserved histidine residue.^[30]^[31] This phosphorylation event activates the response regulator VirG by transferring the phosphate group to an aspartate residue on VirG, enabling the phosphorylated VirG to function as a transcriptional activator.^[32]^[33] Activated VirG binds to conserved vir box sequences in the promoters of multiple vir operons on the Ti plasmid, thereby inducing their expression and preparing the bacterium for T-DNA processing and export.^[32] This gene induction occurs rapidly, typically within 2-4 hours of signal exposure, and is essential for the subsequent steps of virulence.^[34] Optimal induction requires specific environmental conditions, including an acidic pH of approximately 5.5 and temperatures in the range of 25-29°C, which mimic the soil microenvironment near plant wounds.^[35]^[36] Host specificity during this initiation phase is modulated by chromosomal genes that facilitate bacterial attachment and fine-tune vir gene regulation. Genes such as chvA and chvB encode components involved in the synthesis and export of β-1,2-linked exopolysaccharides, which are crucial for stable adhesion to plant cell surfaces and initial host recognition.^[37]^[38] Additionally, the ros gene product acts as a repressor of the virC and virD operons, restricting their expression in non-host environments and thereby contributing to the bacterium's selective activation in compatible plants.^[39] Naturally, A. tumefaciens exhibits a broad host range, capable of infecting species across most dicotyledonous plant families and some monocotyledonous ones, though attachment and signaling efficiency vary by host.^[40]

Processing, Transfer, and Integration Steps

The processing of T-DNA begins with the site- and strand-specific nicking of the Ti plasmid's T-DNA borders by the endonuclease complex formed by VirD1 and VirD2 proteins. This cleavage occurs at the right border (RB), generating a single-stranded T-strand that corresponds to the 5' end of the processed DNA, with VirD2 covalently bound to its 5' terminus to protect it from exonucleases. The VirC protein complex enhances border recognition and facilitates the initial binding of VirD1/VirD2 to the RB, ensuring precise initiation of the nicking reaction. Subsequently, the T-strand is coated by VirE2 proteins, which act as single-stranded DNA-binding factors to form a protective nucleoprotein complex (T-complex) that shields the DNA from degradation during transit.^[20]^[41]^[5]^[3] Transfer of the T-complex from Agrobacterium to the plant cell is mediated by the VirB/VirD4 type IV secretion system (T4SS), a multiprotein apparatus that spans the bacterial inner and outer membranes and forms a pilus-like structure for substrate export. VirD4 serves as the coupling protein that recruits the T-complex to the secretion channel, while the VirB proteins assemble the core translocon, including an ATP-powered motor that drives the energy-dependent export of the T-strand into the plant cell cytoplasm. This process is ATP-hydrolytic, with VirB11 and VirB4 providing the energetic components for substrate translocation across the bacterial envelope and through the pilus to the host cell.^[42]^[43]^[44] Once in the plant cytoplasm, the T-complex is transported to the nucleus, guided by nuclear localization signals (NLS) present in both VirD2 and VirE2, which interact with plant importin proteins to facilitate passage through nuclear pore complexes; VirE2 relies on the host adaptor protein VIP1 for this entry.^[3] Integration of the T-strand into the plant genome occurs primarily through illegitimate recombination, a non-homologous mechanism that does not require sequence homology and often results in small deletions or insertions at the junction sites; this can lead to polar insertion, with the RB-proximal end integrating more frequently than the LB-proximal end. This process is mediated by host plant DNA repair pathways, such as non-homologous end joining (NHEJ), with VirD2 and VirE2 enhancing the precision and efficiency of incorporation by protecting the T-strand ends. In natural infection settings, the overall efficiency of T-DNA integration is low.^[3]^[45]^[46]

Applications in Biotechnology

Plant Genetic Transformation

Plant genetic transformation using transfer DNA (T-DNA) from Agrobacterium tumefaciens relies on established laboratory protocols that facilitate the stable integration of desired genes into the plant genome. The core method involves co-cultivation of Agrobacterium cells harboring engineered binary vectors with plant explants, such as leaf disks, to enable T-DNA transfer. Binary vectors, exemplified by pBIN19, consist of a T-DNA region flanked by border sequences that carry the gene of interest (GOI), regulatory elements like the CaMV 35S promoter for constitutive expression, and selectable markers such as the nptII gene conferring kanamycin resistance to identify transformed cells.^[47]^[47]^[47] In the co-cultivation protocol, plant explants are wounded to promote bacterial attachment and then incubated with Agrobacterium suspension on nutrient media for 2–3 days, allowing T-DNA processing and delivery into plant cells. Following infection, explants are transferred to selective media containing antibiotics to eliminate untransformed tissue and promote regeneration of transgenic shoots and roots through tissue culture techniques, such as callus induction and organogenesis. This approach, originally refined for tobacco using leaf disks, has become a standard for dicotyledonous plants due to its simplicity and high reproducibility. For specific delivery methods, the floral dip technique offers a tissue-culture-free alternative, particularly for Arabidopsis thaliana, where flowering plants are dipped into an Agrobacterium suspension containing surfactants and sugars, leading to transformation of developing seeds and subsequent selection in progeny. Introduced in 1998, this method achieves transformation efficiencies of 0.1–1% without requiring explant regeneration, minimizing the use of alternatives like particle bombardment, which is more labor-intensive and prone to multiple DNA insertions. Regeneration in other protocols remains essential, involving hormone-supplemented media to induce somatic embryogenesis or shoot formation from transformed calli.^[48]^[48] Efficiency of T-DNA-mediated transformation is enhanced by optimizing Agrobacterium strains and cultural conditions; for instance, the GV3101 strain, derived from C58 with disarmed Ti plasmid, supports high virulence and transformation rates up to 65% in certain explants due to its improved T-DNA transfer capability. Supplementation of co-cultivation media with acetosyringone, a phenolic inducer, activates vir genes in Agrobacterium, boosting T-DNA export and integration efficiency by 2–10-fold across protocols. This system has enabled successful stable transformation in over 100 plant species, including major staples like rice, achieved via immature embryo co-cultivation in 1994, and maize, where immature embryos yield transgenic plants at efficiencies of 10–40% with optimized morphogenic regulators.^[49]^[50]^[51]^[52]

Advanced Uses in Research and Crop Engineering

T-DNA has been instrumental in generating large-scale insertion mutant libraries for functional genomics research, particularly in model plants like Arabidopsis thaliana. One prominent example is the TAIR collection, which encompasses over 100,000 T-DNA insertion lines developed in the early 2000s, enabling systematic gene knockout studies to elucidate gene functions across the genome. These libraries facilitate high-throughput screening for mutants with specific phenotypes, accelerating the identification of genes involved in developmental processes, stress responses, and metabolic pathways. Additionally, T-DNA-based promoter trapping integrates reporter genes like GUS or GFP near native promoters, allowing visualization of gene expression patterns in vivo, while activation tagging uses enhancer elements to overexpress nearby genes, uncovering loss-of-function phenotypes through gain-of-function approaches. Such tools have been widely adopted, with collections like the SAIL and SALK lines providing resources for the research community via public databases. In crop engineering, T-DNA-mediated transformation has enabled the development of commercially significant transgenic varieties with targeted agronomic traits. The Roundup Ready soybean, introduced in 1996, incorporates the CP4 EPSPS gene for glyphosate herbicide tolerance, revolutionizing weed management in soybean cultivation and covering millions of hectares globally. Similarly, Bt cotton, engineered with Bacillus thuringiensis cry genes via Agrobacterium tumefaciens, confers resistance to lepidopteran pests, reducing insecticide use by up to 50% in adopting regions since the late 1990s. Another landmark application is the virus-resistant papaya (Rainbow variety), transformed in 1998 with coat protein genes from papaya ringspot virus using T-DNA vectors, which rescued Hawaii's papaya industry from near collapse due to viral outbreaks. More recently, advancements include drought-tolerant maize hybrids developed using T-DNA-mediated transformation, enhancing yield stability under water-limited conditions in field trials. Emerging applications leverage T-DNA for integrating advanced genetic tools, particularly in genome editing and synthetic biology. Since 2014, T-DNA vectors have been optimized for delivering CRISPR-Cas9 components into plant cells, enabling precise multiplexed edits without reliance on particle bombardment, as demonstrated in rice and tomato for traits like disease resistance. In synthetic biology, T-DNA facilitates the insertion of multi-gene metabolic pathways, such as those for biofuel precursor production in tobacco or artemisinin biosynthesis in wormwood, streamlining the engineering of complex traits by exploiting the natural transfer machinery. These innovations, often using binary vector systems for modular cassette assembly, continue to expand T-DNA's utility in precision agriculture and industrial biotechnology. As of 2024, new strategies have advanced T-DNA transformation efficiencies and expanded applications to recalcitrant species.^[53]

Advantages, Limitations, and Alternatives

Benefits and Challenges of T-DNA Systems

T-DNA systems, primarily mediated by Agrobacterium tumefaciens, offer several key benefits in plant genetic transformation. One major advantage is the potential for stable, single-copy insertions into the plant genome, which is predominant in certain protocols such as root-derived transformations, promoting reliable inheritance and expression of transgenes.^[54] This random integration pattern also facilitates insertional mutagenesis, enabling the creation of gene knockout libraries for functional genomics studies without requiring sequence-specific targeting.^[55] Unlike homology-directed repair methods, T-DNA integration occurs via non-homologous end joining, eliminating the need for homology arms and simplifying vector design.^[55] Furthermore, Agrobacterium-mediated transformation is cost-effective and scalable compared to techniques like microinjection or particle bombardment, requiring minimal specialized equipment.^[55] It has gained widespread regulatory acceptance, accounting for approximately 80% of commercial genetically engineered crop varieties due to its efficiency and established safety profile.^[56] Despite these strengths, T-DNA systems present notable challenges. Position effects from random integration sites can lead to gene silencing or variable expression levels, complicating predictable outcomes in transgenic plants.^[55] Multiple insertions or rearrangements occur frequently, with rates ranging from 20% to over 80% depending on the transformation method (e.g., higher in leaf disc assays), potentially disrupting plant physiology or transgene stability.^[54] Host range limitations restrict efficient transformation to dicots and select monocots, though improvements via mutations in virulence (vir) genes, such as virF, have expanded applicability to previously recalcitrant species like cereals. Public concerns over genetically modified organisms, including fears of ecological impacts and long-term health effects, have slowed adoption in some regions despite scientific consensus on safety.^[57] Off-target integration risks, inherent to the random nature of T-DNA insertion, may inadvertently affect endogenous genes, raising biosafety considerations.^[58] Several strategies mitigate these challenges. Minimal T-DNA vectors reduce extraneous sequences, lowering the incidence of rearrangements and improving integration precision.^[55] Gateway cloning systems enable rapid and modular assembly of T-DNA constructs, facilitating precise transgene placement and reducing experimental variability.^[55] In the 2020s, advanced enhancer trapping approaches using T-DNA have been developed to monitor and control gene expression patterns, as demonstrated in non-model plants like Marchantia polymorpha, enhancing regulatory control over insertions.

Comparisons to Other Gene Transfer Methods

Transfer DNA (T-DNA), delivered via Agrobacterium-mediated transformation, contrasts with biolistic methods (gene gun) in terms of tissue integrity and integration stability. Biolistics involves bombarding plant cells with DNA-coated gold or tungsten particles, enabling rapid transformation without biological intermediaries, which makes it preferable for recalcitrant species like monocots where Agrobacterium efficiency is lower. However, T-DNA transfer causes minimal physical damage to tissues, reducing cell death and promoting higher rates of stable, single-copy insertions compared to biolistics, which often leads to multiple copy integrations, genomic rearrangements, and higher silencing risks. For instance, in soybean transformation, Agrobacterium achieves stable expression with fewer rearrangements than biolistics, though the latter can yield results faster in species like wheat. Thus, T-DNA is favored for applications requiring long-term heritability, while biolistics suits quick prototyping despite its 10-20% tissue damage rates.^[59]^[60] Compared to viral vectors, such as those derived from geminiviruses, T-DNA excels in handling larger DNA inserts and achieving stable genomic integration. Geminiviral vectors, which replicate episomally in the nucleus, are limited to cargo sizes of approximately 2-3 kb due to packaging constraints, making them ideal for transient expression or delivering small CRISPR components but unsuitable for complex transgenes exceeding 10 kb. In contrast, T-DNA borders facilitate transfers up to 150 kb with high fidelity, enabling nuclear integration and inheritance across generations, as demonstrated in tomato where geminivirus vectors achieved only 10-fold higher transient efficiency but lacked stability. Viral methods avoid integration mutagenesis but often result in transient phenotypes, whereas T-DNA's stable expression supports commercial crop engineering, though it faces biosafety scrutiny. Geminiviruses are thus preferred for rapid gene silencing or editing in non-heritable contexts.^[61]^[62] Direct physical and chemical methods like electroporation and polyethylene glycol (PEG)-mediated uptake differ from T-DNA by bypassing biological vectors but suffer from lower overall efficiency in intact plants. Electroporation uses electric pulses to permeabilize protoplast membranes, achieving up to 50% transient transformation in isolated cells, while PEG induces DNA uptake chemically, often reaching 10-20% in protoplasts of species like tobacco. These methods are simpler and equipment-light for protoplast systems, avoiding Agrobacterium's host limitations, but regeneration from protoplasts is inefficient (<1% stable plants) due to cell wall reformation challenges and genotype dependency. T-DNA, conversely, yields 10-50% stable transformation efficiencies in whole tissues of dicots and optimized monocots, with better regeneration via natural infection sites. Direct methods are thus advantageous for preliminary studies in protoplast-friendly plants but lag in scalable, stable transgenics.^[63]^[64] In the 2020s, CRISPR ribonucleoprotein (RNP) complexes have emerged as alternatives for precise editing without foreign DNA integration, contrasting T-DNA's stable transgenic approach. RNPs, comprising Cas9 protein and guide RNA, are delivered directly via biolistics or PEG, enabling transgene-free mutations with efficiencies up to 71% in Arabidopsis protoplasts and reduced off-target effects due to their transient nature. Unlike T-DNA, which integrates entire constructs for heritable expression, RNPs focus on targeted knockouts or edits without leaving selectable markers, accelerating regulatory approval for non-GMO crops. However, RNPs struggle with large insertions or stable overexpression, areas where T-DNA remains superior, as seen in rice where RNP editing achieved 19% homology-directed repair but required T-DNA for full trait stacking. T-DNA is thus preferred for creating stable transgenic lines in crop engineering.^[65]^[61]

References

[1]
T-DNA Binary Vectors and Systems - PMC - NIH
(1) T-DNA left and right border repeat sequences to define and delimit T-DNA. T-DNA border repeat sequences (T-DNA borders) contain 25 bp that are highly ...
[2]
Pathways of DNA Transfer to Plants from Agrobacterium ... - NIH
Agrobacterium tumefaciens is often described as a natural genetic engineer, equipped to horizontally transfer bacterial genes and genetically transform plant ...
[3]
Nuclear Import of Agrobacterium T-DNA - NCBI - NIH
The transferred DNA (T-DNA) is escorted, by two bacterial proteins, as a single-stranded DNA-protein complex (a T-complex), which mediate its transport to the ...
[4]
The Agrobacterium Ti Plasmids - PMC - PubMed Central - NIH
T-DNA genes expressed in plant cells. Octopine-type Ti plasmids carry two T-DNA fragments designated TL-DNA and TR-DNA of 13 and 7.8 kb in length, respectively ...
[5]
Agrobacterium tumefaciens VirC2 enhances T-DNA transfer and ...
Jun 16, 2009 · The T-DNA region is flanked by two 25-bp sequences designated left and right borders, which are highly homologous and are oriented in a ...
[6]
Agrobacterium tumefaciens transfers single-stranded ... - NIH
Transferred DNA (T-DNA) is transferred as a single-stranded derivative from Agrobacterium to the plant cell nucleus.Missing: definition | Show results with:definition
[7]
Regulation of Oncogene Expression in T-DNA-Transformed Host ...
Jan 23, 2015 · These genes are transferred by the T-DNA of the plant pathogen Agrobacterium tumefaciens and include the oncogenes IaaH, IaaM and Ipt, which, ...
[8]
The genome sequence of hairy root Rhizobium rhizogenes strain ...
May 1, 2021 · The agropine Ri plasmid has two T regions, one of which, the TL region, contains the rol‐genes that are necessary and sufficient for the ...
[9]
Agrobacterium tumefaciens T-DNA - Genes & Development
Agrobacterium T-DNA contains genes that affect phytohormone levels, including auxin and cytokinin, and are transferred to plants, integrated into their nuclear ...
[10]
https://doi.org/10.3389/fpls.2014.00155
[11]
https://doi.org/10.1128/MMBR.67.1.16-37.2003
[12]
https://doi.org/10.3389/fpls.2014.00326
[13]
A Plant-Tumor of Bacterial Origin - Science
A Plant-Tumor of Bacterial Origin. Erwin F. Smith and C. O. TownsendAuthors Info & Affiliations ... Crown Gall Disease: A Growing Threat to Fruit Tree Health and ...Missing: discovery | Show results with:discovery
[14]
THE TUMOR-INDUCING - Annual Reviews
The evidence for perpetuation of crown gall tumors in the absence of bacteria seems unequivocal, based on the early work of Braun & White (39) and on the axenic ...
[15]
Progress of cereal transformation technology mediated by ... - NIH
Ovules are transformation-competent. Strains engineered with modified T-DNA could enter hosts through wounds and reach locules.
[16]
Short direct repeats flank the T-DNA on a nopaline Ti plasmid - PNAS
The presence of the 25-bp direct repeats at the edges ofT-DNA pro- vides the first clue to the mechanism of illegitimate recombi- nation between prokaryotic Ti ...
[17]
Right 25 by terminus sequence of the nopaline t-DNA is essential for ...
The results indicate that the 25 by T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer.
[18]
PURIFIED PROTEINS VirD1 AND VirD2 CATALYZE SITE- AND ...
In the present study we demonstrate that the proteins VirD1 and VirD2 together are sufficient to catalyze the T-border-specific cleavage on dsDNA in vitro.
[19]
Role of the overdrive sequence in T-DNA border cleavage in ... - PNAS
right T-DNA and the overdrive sequences suggest that the. VirD2 protein interacts with both the T-DNA border and overdrive, whereas VirC1 specifically ...
[20]
WO2001044482A2 - Optimized t-dna transfer and vectors therefor
To decrease T-DNA left border read-through, said method can be applied alone or in conjunction with transformation vectors containing modified T-DNA borders.
[21]
The right border region of pTiT37 T-DNA is intrinsically more ... - PNAS
The right border region of pTiT37 T-DNA is intrinsically more active than the left border region in promoting T-DNA transformation. G C Jen and M D Chilton ...
[22]
Structure of T-DNA in plants regenerated from roots transformed by ...
The TR-DNA can be absent, and its size varies from about 5–28 kb, with two predominant lengths. The smaller size does not include the region homologous to the ...
[23]
The pCLEAN Dual Binary Vector System for Agrobacterium ... - NIH
pCLEAN vectors contain a minimal T-DNA (102 nucleotides) consisting of direct border repeats surrounding a 52-nucleotide-long multiple cloning site, an ...
[24]
Genome structure of Ri plasmid (3). Sequencing analysis of the vir ...
The vir region covering 30.2-kb has found to be composed of 21 genes resembling virH1, virA, virB1-11, virG, virC1-2, and virD1-5.
[25]
The genetic and transcriptional organization of the vir region of the ...
Mutations in these loci eliminate (virA, virB, virD and virG) or significantly restrict (virC and virE) the ability of Agrobacterium to transform plant cells.
[26]
Ti plasmid conjugation is independent of vir: reconstitution of the tra ...
Each contains the oriT site and the two flanking, divergently transcribed tra operons that encode the DNA processing functions associated with the relaxosome.
[27]
The Ti Plasmid, Driver of Agrobacterium Pathogenesis - APS Journals
Apr 26, 2023 · The bacterium and its Ti (tumor-inducing) plasmid is better known as an effective vector for the genetic manipulation of plants and fungi.
[28]
Agrobacterium tumefaciens responses to plant-derived signaling ...
Vir genes code for a set of proteins with different functions such as T-DNA excision and processing (virC and virD), coating and protecting T-DNA during ...
[29]
Reconstitution of Acetosyringone-Mediated Agrobacterium ... - NIH
In A. tumefaciens, the expression of virulence genes is under the control of a two-component regulatory system comprised of VirA and VirG (45, 52). VirA ...
[30]
Control of expression of Agrobacterium vir genes by ... - PNAS
The signal detected by the VirA protein must be transduced to the VirG proteinto activate the latter protein. Activated VirG is thought to act as a positive.
[31]
The Integrity of the Periplasmic Domain of the VirA Sensor Kinase Is ...
The plant pathogen Agrobacterium tumefaciens responds to three main signals at the plant-bacterium interface: phenolics, such as acetosyringone (AS), ...
[32]
https://www.pnas.org/doi/pdf/10.1073/pnas.87.17.6684
[33]
Stable pH Suppresses Defense Signaling and is the Key to Enhance ...
Nov 20, 2018 · The induction of vir genes by the phenolic compound AS can be activated at acidic pH 5.5-6.0, so we used the defined AGROBEST medium buffered ...<|separator|>
[34]
Temperature affects the T-DNA transfer machinery of Agrobacterium ...
In the presence of acetosyringone, the optimal temperature for vir gene induction was 258C (Fig. 1).
[35]
Agrobacterium‐induced tumour formation in plants by ... - EMBO Press
This soil‐borne Gram‐negative bacterium is a broad‐host range plant pathogen, which initiates tumour formation on most dicotyledonous and some monocotyledonous ...Agrobacterium Vir Gene... · Nuclear Transport Of The... · Agrobacterium And The Plant...
[36]
Transferred DNA (T-DNA)-associated proteins of Agrobacterium ...
The transfer of T-DNA from Agrobacterium to plant cells is mediated by a system which involves the virB operon of the Ti plasmid.Results · Vire2 And Vird2 Are Secreted... · Secretion Of Vire2 And Vird2...Missing: promoterless | Show results with:promoterless
[37]
Analysis of the Ros repressor of Agrobacterium virC and virD operons
The products of the genes of the virC and virD operons play an important role in host specificity and T-DNA processing.
[38]
The roles of bacterial and host plant factors in Agrobacterium ... - NIH
The exceptional ability of Agrobacterium to transfer a part of its own DNA to the host plant genome represents a rare case of naturally occurring horizontal ...
[39]
Import of Agrobacterium T-DNA into Plant Nuclei - NIH
In the presence of the VirD1 protein, VirD2 nicks the border sequence in a site- and strand-specific manner and covalently attaches to the 5′ end of the nicked ...
[40]
The Agrobacterium VirB/VirD4 T4SS: Mechanism and Architecture ...
The VirB/VirD4 T4SS is a type IV secretion system used by Agrobacterium to deliver oncogenic DNA and proteins to plant cells, causing crown gall.
[41]
Energetic components VirD4, VirB11 and VirB4 mediate early DNA ...
Abstract. Bacteria use type IV secretion systems (T4SS) to translocate DNA (T-DNA) and protein substrates across the cell envelope.
[42]
Structure of a VirD4 coupling protein bound to a VirB type IV ...
T4S systems are generally composed of 11 VirB proteins and 1 VirD protein (VirD4). The VirB1‐11 proteins assemble to form a secretion machinery and a pilus ...
[43]
Trans-kingdom T-DNA transfer from Agrobacterium tumefaciens to ...
This contrasts with integration in the plant genome, where T-DNA integrates preferentially via illegitimate recombination.
[44]
Agrobacterium proteins VirD2 and VirE2 mediate precise integration ...
In vitro synthesized transferred DNA (T-DNA) complexes comprising single-stranded DNA and Agrobacterium virulence proteins VirD2 and VirE2, essential for plant ...
[45]
Agrobacterium infection and plant defense—transformation success ...
The lower T-DNA integration efficiency in the indica cultivar may also be attributable to the specific repression of genes related to DNA damage repair.
[46]
Binary Agrobacterium vectors for plant transformation - PubMed
A vector molecule for the efficient transformation of higher plants has been constructed with several features that make it efficient to use.
[47]
Floral dip: a simplified method for Agrobacterium ... - PubMed
The Agrobacterium vacuum infiltration method has made it possible to transform Arabidopsis thaliana without plant tissue culture or regeneration.Missing: paper | Show results with:paper
[48]
Evaluation of four Agrobacterium tumefaciens strains for the genetic ...
Oct 26, 2012 · The highest transformation rate (65 %) was obtained with the Agrobacterium strain GV3101, followed by EHA105 (40 %), AGL1 (35 %), and MP90 (15 %).
[49]
Acetosyringone treatment duration affects large T-DNA molecule ...
Aug 9, 2018 · By performing virD2 immuno-precipitation, we monitored a time course of the T-strand accumulation in Agrobacterium upon AS induction, and ...
[50]
Agrobacterium-Mediated Plant Transformation: the Biology behind ...
Stimulation of Agrobacterium tumefaciens T-DNA transfer by overdrive depends on a flanking sequence but not on helical position with respect to the border ...
[51]
Efficient transformation of rice (Oryza sativa L.) mediated ... - PubMed
Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 1994 Aug;6(2):271-82 ...
[52]
https://pubmed.ncbi.nlm.nih.gov/7920717/
[53]
Agrobacterium-mediated plant transformation: biology and ...
Agrobacterium tumefaciens is a soil phytopathogen that naturally infects plant wound sites and causes crown gall disease via delivery of transferred (T)-DNA ...
[54]
https://doi.org/10.1007/BF00021539
[55]
Recent progress in Agrobacterium-mediated cereal transformation
The modified bacteria are co-cultivated with immature embryos of a compatible cereal plant genotype, resulting in T-DNA transfer and integration into the genome ...
[56]
The complex architecture and epigenomic impact of plant T-DNA ...
Optical maps for four randomly selected T-DNA lines revealed between one and seven insertions/rearrangements, and the length of individual insertions from 27 to ...
[57]
https://www.sciencedirect.com/science/article/pii/S2214514124000126
[58]
https://pmc.ncbi.nlm.nih.gov/articles/PMC6338467/
[59]
https://doi.org/10.1016/j.plantsci.2023.111789
[60]
https://doi.org/10.1016/S1369-5266(03)00027-2
[61]
https://doi.org/10.1038/s41587-020-0455-x
[62]
https://doi.org/10.1105/tpc.113.119792
[63]
https://doi.org/10.3390/ijms20102594